CShisMan2_2585


Sequence

>CShisMan2_2585 (2 EST) Length=141 CGAGGCGTCCTGTGCGGATTTCGAAGGGTCCGCAAGGATCGATCGATCGCGTCAGTGCTACCAGGAATACCCAATTCGAC CCTATAGTGTAATCAGTATTACAATTCACTGGACCAGATCAGATTTTACAAGCATCGTACT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig, dbEST,


Cluster Information for CShisMan2_2585: (2 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
15469622897583AA825105SMTBSOA000008SKSchistosoma Lambda Zap II
16891143116483AA952777SMTBCEA000008SKSchistosoma Lambda Zap II cercariae


Date: 17:18:5 on Thu 23 Nov 117.