CShisMan2_2596


Sequence

>CShisMan2_2596 (3 EST) Length=139 TCGAGCCACTACTAGCCCCTCTCTTCGTACTTCTGCATTGTTCTCGATAACTGTTTCATTACTCCAAAAAGGCAGCCGAC TACAGGTGAATATGTTGTTCGGTAGTTCTGACGGCTGTACAAGTATTTCGTCGTTGTCG


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig,


Cluster Information for CShisMan2_2596: (3 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
7364701644606AA098636SMTBADAMS0637SKS. mansoni cDNA
16890953116464AA952758SMTBADA000637SKSchistosoma Lambda Zap II
16891883116557AA952851SMTBCEA000523SKSchistosoma Lambda Zap II cercariae


Date: 7:37:45 on Sat 18 Nov 117.