CShisMan2_2599


Sequence

>CShisMan2_2599 (3 EST) Length=141 GTCGATTGCAACATCGAATAACCACACTGAATCCTATTCTTTAGATACTGATAAGAATTGGGCTAATTTTCAAATAGAAG AAGATTTAGATAAGAATAACCTTGGAAACTGGGCTGATTTTAATCAGACTCCGACTACTAC


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig,


Cluster Information for CShisMan2_2599: (3 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
344437972838L46970SCMRAP057C2/tcz2 adult worm mini-library
344457972858L46990SCMRAP077C2/tcz2 adult worm mini-library
344786974643L47046SCMRAP1333303/TCZ2 adult worm mini-library


Date: 14:24:5 on Sat 18 Nov 117.