CShisMan2_26


Sequence

>CShisMan2_26 (7 EST) Length=671 GGGTAGTACATCTGTAAAAACTTTGTAAAATCCAAGACAGTTAATTTACAAGATGTGGTGTNTGTTTCAGATGAATAAGT GTGGACATAATTCTCGTTATCTGTTACGAAAACTAGTGAAACGTGGCCTTTCAAGTGATTTATGTACCAGTTAGCAGCAA CCCAATTCATTCTTGTTGTGTAATCTTTAAGGATCTCGTCCGCAAAAGGAGGACGAAAACAGGAGCGATTAAACTCGTTA TCAAATAAAATGCATGTTTGGCTAGCATCTTCAAGACTTGAACGAATTCTCTTATATGGGCGTTTCGTTGAGGCCTGTTG CTGAACAAAATTCACCGACGACAGTGAAACAATAACACCCTTTATGTCTTCAAGCTCAAATAGTTCCCAGTAGTTGAGAG CATAAAATCCATCGATTAAAATGTACGTTTCCAAGTCTCTTGGTAAGCAATGTCCACCTTGATGGCACTCAACCTGAGAG CACGACAAACTTCTGCATGGTATGTCGTCCCGAAGATAGACTTCTCTTGTCAAACAAACCTCTTTACCTCTGGGAGTCTT GTATCTGATAGTCTTTTCTGACTTTTCGCGCAGGACTGTATAGCCACCAACCATCCCTGTGAAATATTTATGCAACACAG ATAAGCTGGGGACTTAAGAGGCGTCTCGTGC


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig, gbnr,


Cluster Information for CShisMan2_26: (7 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
18147203385080AI067113EST208783Schistosoma mansoni, Phil LoVerde/Joe Merrick
18153353385695AI067728EST209411Schistosoma mansoni, Phil LoVerde/Joe Merrick
18154833385843AI067876EST209561Schistosoma mansoni, Phil LoVerde/Joe Merrick
18155523385912AI067945EST209633Schistosoma mansoni, Phil LoVerde/Joe Merrick
18158713386231AI068264EST209955Schistosoma mansoni, Phil LoVerde/Joe Merrick
18158863386246AI068279EST209970Schistosoma mansoni, Phil LoVerde/Joe Merrick
18159433386303AI068336EST210027Schistosoma mansoni, Phil LoVerde/Joe Merrick


Date: 2:44:23 on Mon 20 Nov 117.