CShisMan2_261


Sequence

>CShisMan2_261 (4 EST) Length=510 ANANACTGATGAATCTTCTAGAGATTTATTTCTTATCACTATAACCAATAATATACAAACGCAAACATTTTCTGAGAAAA TGATAAAACAAATAGACAGTATGATCTACAGATGAAATGAATCTTAGTTTTAATTTCTACAGTTAGTAATACAGAAGAGT CATAAGAAATTAAAATAAAATAGTGACAGAAGAAACAATAAATTCACTAGAATAATGAAATTTTGCGTTTTCATCTATTA TAGTCACTGAAACCGCCTACTGGTAGTGTTCCAGCTAGTACATAGATAAATGAAGGTTTGGAAGACTAAGTAAAAATCCT TCACTACATACGCTTTTTTTAACGATGCTCTGAATGATTAGCCAAACAACAAATAAAGTTCTTTGGATCAAACTGACGTG TACACAACTTATGTACAGCTGTAAATATAGGATACNTCTCAAGAAGACCCTTGCGTTCCAGCATTGCATAGACTTCTGCA GCAGTGAGAGGACCTTGAGCACTTTGACCG


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig, gbnr, dbEST,


Cluster Information for CShisMan2_261: (4 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
12097932330082AA559386MC260332.NA3TBRI-Saber-cercaria-A
12097942330083AA559387MC260335.NA3TBRI-Saber-cercaria-A
17369603189880AA999325MCCE3140.M1FSchistosoma mansoni, cercariae
17371243190044AA999489MCCE3383.M1FSchistosoma mansoni, cercariae


Date: 3:48:58 on Sat 18 Nov 117.