CShisMan2_263


Sequence

>CShisMan2_263 (21 EST) Length=739 AGCGCCTGATTCTTCAAGCACTACCATGTTACGACTTAACTCAACTTATTGTCGAGATTGTCGGGCGATGTGTACGTAAA CTATTTCAACCTTCGAGATAACGTACTATTAAACCCCTACTTCCGAGTCCTAAATCTGAGTAAATTTCATTTACTATTTT TGTAAATGTAACGCATAACAACCTATAATATTAGCAGCATATAGACCTGTCTTAAATTACCTAATATTTACTCACTTATT ATCTCTAAATGTAAATATACAAACGGATATACACTAACAAATCTAATTATAGTGAAATATTTAGCGGACCATCTCTTTAA TGTACACGTTCCCCCGGACGAATTTAATTTACCGCCAAACCCTTTCAGTTATAACTGTGGACAAAAACTTTATAATCTAA TAAAGGGGTCTCCAATCCCTATTTTGCTCAGATTCTTCTATACATTATTGAGTTATTTTCCAACAGAAACCTATTTTACC AACACACTTCCTAACTTACTCAATAATTATTTCAACCAACAAATAAAATGAGAAGAAGACAGTTTAACCGCGACTGCTGG CACTGTGACTTAGCCTCTTCTAACGACTAGTAACCATCATTAAATCTCTTTATACTAACAGTCCTAACTACTACCAATTA AAAATTTTTAATTCATACTTAACCAACCATATAATATCCGTATGTAGCTTCTACTAATCACATTTCTACGCCACTACCAT GGCGGAATCGGGCAGGGTT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig, dbEST,


Cluster Information for CShisMan2_263: (21 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
39350514744T14577SMEST0238Schistosoma mansoni, adult worm, Gloria Franco
345057981324R95664SMNHADA020094SKSmAW
4071631119169H98284SMNHADA015086T3SmAW
4190071126894N21724SMNHADA00E027SKSmAW
4190521126939N21769SMNHADA018011SKSmAW
4191931128044N21911SMNHADA019086SKSmAW
7790951702754AA140594MEEG0131.M1FSchistosoma mansoni, egg stage
12099212330210AA559514MC280423.NA3TBRI-Saber-cercaria-A
12099632330252AA559556MC070560.NA3TBRI-Saber-cercaria-A
12101772330466AA559770MC210214.NA3TBRI-Saber-cercaria-A
12101932330482AA559786MC210283.NA3TBRI-Saber-cercaria-A
12102082330497AA559801MC250467.NA3TBRI-Saber-cercaria-A
12165712338820AA566188MA3MR060.AA3S. mansoni adult Lambda Zap
15233902870792AA801620SMTBADA000859SKSchistosoma Lambda Zap II
17368803189800AA999245MCCE3029.M1FSchistosoma mansoni, cercariae
17368843189804AA999249MCCE3043.M1FSchistosoma mansoni, cercariae
17369463189866AA999311MCCE3125.M1FSchistosoma mansoni, cercariae
17370453189965AA999410MCCE3263.M1FSchistosoma mansoni, cercariae
17371653190085AA999530MCCE3444.M1FSchistosoma mansoni, cercariae
17372473190167AA999612MCCE3584.M1FSchistosoma mansoni, cercariae
18151453385505AI067538EST209220Schistosoma mansoni, Phil LoVerde/Joe Merrick


Date: 16:14:12 on Mon 20 Nov 117.