CShisMan2_2630


Sequence

>CShisMan2_2630 (2 EST) Length=135 TGTTCAAGAACCAAAATAAACTTTGATTACTAATTTAAGAAGACTAATTCTTTTTTTTCTCTCGCTGTCTAGTTGTCTTC ATATGTGTACCTCTTTCATGACCTCTTCGCATTATTATTTTTCTTTATTTCATGC


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig, dbEST,


Cluster Information for CShisMan2_2630: (2 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
3644521017379H63033EST000304S. mansoni cDNA
16715933096897AA938786SMTBADA000304SKSchistosoma Lambda Zap II


Date: 2:0:2 on Sat 18 Nov 117.