CShisMan2_2634


Sequence

>CShisMan2_2634 (2 EST) Length=192 AAGAAAAAAAATTTTTTTTTGAAAATAAGTTGAGCGAAAATTTTGAATAAAAAATGACAAACCCCTCGAAAAATCGTGTT GGTAACAAAAGATAAACAATATAAGATTTATTTCATATAGTTTTTGTTGTTGTTGATTATATCATCTGTTAGCGATGAGA TAATTACATGAAGTTATAATTGAATACGGATG


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig, dbEST,


Cluster Information for CShisMan2_2634: (2 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
344419972820L46952SCMRAP039C2/C2 adult worm mini-library
350222988853H49012EST000107S. mansoni cDNA


Date: 15:18:13 on Fri 24 Nov 117.