CShisMan2_2657


Sequence

>CShisMan2_2657 (2 EST) Length=130 CAGATCTGTTATCATTATGATTNGTGCATGTTATTTGTAAATTTATCTGAATTTAAATACTAGATACAGTTTCCCCATTT TCATCAAGCCAAATGCAAGTGTTGAGAATATGTTTAGTTTTGCCTGTTTG


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig,


Cluster Information for CShisMan2_2657: (2 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
344808974665L47068SCMRAP155C2/25RY adult worm mini-library
344826974683L47086SCMRAP173C2/25RY adult worm mini-library


Date: 1:56:38 on Sat 18 Nov 117.