CShisMan2_2663


Sequence

>CShisMan2_2663 (2 EST) Length=130 GTGTTAANAAACAAGGGACGAATTAATGTAACTTATTATCTCAACATACTGAATAAACGGAAGAATCCATATCGGACTAC CTTCTGGAATCATNCTACCAAAAAACTCAACAGAAGAGACATNTTANGCG


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig, gbnr, dbEST, Processing,


Cluster Information for CShisMan2_2663: (2 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
344426972827L46959SCMRAP046C2/tcz2 adult worm mini-library
344815974672L47075SCMRAP162C2/25RY adult worm mini-library


Date: 6:14:6 on Sun 19 Nov 117.