CShisMan2_2702


Sequence

>CShisMan2_2702 (2 EST) Length=120 GCACTAAACACTCCACAGTATAGTGTTTCAACTACTAATGATAAATTATTTTTTCATCAATTTATTCAAGCATTAAAAAC TGTTGTTGCTGCTGCTGCTGAAAAAGGAGAAGGTACATGT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig,


Cluster Information for CShisMan2_2702: (2 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
7364681644604AA098634SMTBADAMS0636SKS. mansoni cDNA
16890943116463AA952757SMTBADA000636SKSchistosoma Lambda Zap II


Date: 17:49:21 on Fri 17 Nov 117.