CShisMan2_2713


Sequence

>CShisMan2_2713 (9 EST) Length=115 GTTTCAGGAGCGAAGACGGTGGTGTTGGTTTGGCGATGGAGAGAGTGGACTGTGAAGAGGTGTAGTTGTATCGAGAGATG TGAGCGAGCGAGTGTATTTTTGAATTGGAGTGTAC


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig, dbEST,


Cluster Information for CShisMan2_2713: (9 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
344424972825L46957SCMRAP044C2/tcz2 adult worm mini-library
344448972849L46981SCMRAP068C2/tcz2 adult worm mini-library
344476972877L47009SCMRAP0963303/TCZ2 adult worm mini-library
344477972878L47010SCMRAP0973303/TCZ2 adult worm mini-library
344488972889L47021SCMRAP1083303/TCZ2 adult worm mini-library
344765974621L47024SCMRAP1113303/TCZ2 adult worm mini-library
344772974628L47031SCMRAP1183303/TCZ2 adult worm mini-library
344775974631L47034SCMRAP1213303/TCZ2 adult worm mini-library
344785974641L47044SCMRAP1313303/TCZ2 adult worm mini-library


Date: 18:17:42 on Fri 17 Nov 117.