CShisMan2_2717


Sequence

>CShisMan2_2717 (2 EST) Length=116 GCAGAAACATTTTATGGAAATAAGTTCGGTAAAGACAGGATAGTGATCATTAAAGATTCAAATATTGTGGACGAAAAACA ATTAGATAGTGATAAAGGTTATCTTCAAATCCTATT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig, gbnr,


Cluster Information for CShisMan2_2717: (2 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
7364781644614AA098644SMTBADAMS0711SKS. mansoni cDNA
16891123116481AA952775SMTBADA000711SKSchistosoma Lambda Zap II


Date: 16:35:56 on Sat 18 Nov 117.