CShisMan2_272


Sequence

>CShisMan2_272 (5 EST) Length=835 GGAAAATGATACACATACATTGATATGAATATTTCTTAAACGAGAAAACTCAAGAAGATATTCATTCAAGGTTTAAAATT TACAATCCAAAACAGTTATATTAAGCAAAAAGTGTAAATTTTTAAAAAGTACAAATATTGTTTTTAGTCACTTGGTACTA TTATCTTATTCTAAAATTGAAAGTAATTGAGATGCACATGCTCGTACATCAGAACAAACTGTAGGTGTTGTTATCCAGTA ATTGATAATTTTGCGAACTGATTCCCAGGCGGTAAATTCATCAACATTATTATCAATAATTACATCGTTATCAACACTTC GAGATAAATCTTTCAAACCAATCATAGCTGATGCAAGAATACGAATACGTTGTGTTTTTAACTGCTCTTCTGTTGAATTT AACTCTGAAGTTACTGATAATAAACAGGTGCCAATTGATACNAATAAGTGATTTACAGCTTCAGGNTGTAATTGTGTAAC ACCACNACAACCATGATCCAGGGCAAGTTGATAAAATATTCAGACTTATTCGAATACCAAACACCAGATATAAAACGCAG TTGCGGAAATATATTTGACTCGATAGATAACGGTTTCGACAAATGAACAAGTACAGAAATATTATACATCAAGTTGNCCA ACGCAATCTGTTGTGGTTTACGTATTGCAAACTGCAATTTATTATCATTAACAAGTTCAATCAATCTCCCAGTTATTCCA ACAGCAGTAATTAAAGATTTTGGTGGAATATTTGGTTTATCACTACTATTCGTTAAGGATGAAGATGATGATGATGACAC AGACTGACGCTTAATAGTATCACTCGTTCCGAATT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig, dbEST,


Cluster Information for CShisMan2_272: (5 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
4156601122603H98382SMNHADA015055T3SmAW
4350081154032N33633SMNHADA007029SKSmAW
5679151366663W59925EST000443S. mansoni cDNA
8578021832562AA218469MAAD0131.M3RSchistosoma mansoni, adult worm (Rabelo, E. and Pena S.D.J.)
12165522338801AA566169MA3MA137.AA3S. mansoni adult Lambda Zap


Date: 11:57:16 on Fri 24 Nov 117.