CShisMan2_2751


Sequence

>CShisMan2_2751 (2 EST) Length=76 GTCAAGTGCACTTTTCTCAGGGGTGTTCAACACAGACCGGCACTGCTGCCTGTCTTGCCTATTGGTTAACGCGNGC


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig,


Cluster Information for CShisMan2_2751: (2 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
344427972828L46960SCMRAP047C2/tcz2 adult worm mini-library
4621971196864L76126SCMRAP0220C2/tcz2 adult worm mini-library


Date: 20:54:58 on Sun 19 Nov 117.