CShisMan2_2759


Sequence

>CShisMan2_2759 (2 EST) Length=104 GGGGAGTTTATCACTTCCGCTTTGCGCCCTATGACGAAGAGGATTCCCACTGTTTTTCAGCTAGTGACTGATATAGATGG GCCTGAAAGCCGTGTATTGTGCTA


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig,


Cluster Information for CShisMan2_2759: (2 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
4236351139736N25388EST000559S. mansoni cDNA
7364511644587AA098617SMTBADAMS0559SKS. mansoni cDNA


Date: 17:10:43 on Fri 24 Nov 117.