CShisMan2_277


Sequence

>CShisMan2_277 (20 EST) Length=1120 GGGGTTATGTTATTACCATTATTATTATTATTATTATTATAACAGTTCACTTGTATAAACAGTTCATATTAGTTTAATAT AAAGATCATTTTTCATGTTGTTTGCATTTGTATTTTATTCACCTATGTTTACCAATATCACTGTTCGTTTTCTTCATCTT CTCCGTCGTCTTCGCCATGTTGTGGTATAGTTTGTGGTTCTTCTGGATGTGGTGTTGGTTGTGGTTTGTACCTATTTCCA TATTTTTTATACTTTCCTTTTCCCCTCTTTCCTTTCGTTCCTTTCGTTCCTTTGGTTCCTTTCGTTCCTTTCTTGGATGA TTTTGTTTTGCTTGAAACGCGTTTGTTTGACGGTTTGTATTTCTTATATTTAACATATCTAGTAGGCTTAAATTCGTTCT CTTCTGTTTCATCGGGTTTATTATCTTCGCCTTCCTCATTATTAACGTTTTCTCCTACGTNACCACTAGGTTGTTCGTTT GAATTAGAAGGTATAGGAGTAGGATGAGGAGGAGGAGGAGAAGGTTGTGGTGTCTGATAATCAGGTATATAATTTCCATA TTGATCATATTTACTAGGATCTTTTGGTTTTTTAACATACGTTTCTTCACCTACTAATCCATAACCTTCTCCTTCATAAT ATCTTGGTTTATACCGATGTCCACTGAGAACTAACTCTCTCAATTCACTATCATATTTATCTAAATCATCATAATATCCG TGATAACGACTATGGTTATAGTGTGGCCGACCATAATTCTCGTCGCCATCAGGCTCATGTGGTGCTTCAGGTTTTTCAGG AGGTGCTCGAGGTGGTTCTTGATCATCATCAGGATATGGAGGTGACGGTTCACCTTCTCCAGGTGAATTATGTGCTGGGG GATGTTGAGGATGATTATCATAATTTCCTGAATGATACCCACCATGTGAACCATAATCATCGTCGAAAAATGAACCTTCA AAGTCATCATGATCATCATATGAATATCTTTCATGACTGTAAATTGGTGATATACATGTGATCAAATAAAAATAAATCAA GAGCATATTTTACCGCTTCTTTTATATATATATATATATATTCTTAAATAGACCTTGCTTTTATTTAATTTCAATAGATT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig, gbnr, dbEST,


Cluster Information for CShisMan2_277: (20 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
14785752804071AA756901MF4MA143.AF3S. mansoni female adult Lambda Zap
18147793385139AI067172EST208844Schistosoma mansoni, Phil LoVerde/Joe Merrick
18148903385250AI067283EST208960Schistosoma mansoni, Phil LoVerde/Joe Merrick
18149993385359AI067392EST209073Schistosoma mansoni, Phil LoVerde/Joe Merrick
18150973385457AI067490EST209172Schistosoma mansoni, Phil LoVerde/Joe Merrick
18151043385464AI067497EST209179Schistosoma mansoni, Phil LoVerde/Joe Merrick
18151103385470AI067503EST209185Schistosoma mansoni, Phil LoVerde/Joe Merrick
18151513385511AI067544EST209226Schistosoma mansoni, Phil LoVerde/Joe Merrick
18153243385684AI067717EST209400Schistosoma mansoni, Phil LoVerde/Joe Merrick
18154123385772AI067805EST209489Schistosoma mansoni, Phil LoVerde/Joe Merrick
18154723385832AI067865EST209549Schistosoma mansoni, Phil LoVerde/Joe Merrick
18155533385913AI067946EST209634Schistosoma mansoni, Phil LoVerde/Joe Merrick
18156023385962AI067995EST209684Schistosoma mansoni, Phil LoVerde/Joe Merrick
18156223385982AI068015EST209704Schistosoma mansoni, Phil LoVerde/Joe Merrick
18157353386095AI068128EST209818Schistosoma mansoni, Phil LoVerde/Joe Merrick
18158323386192AI068225EST209916Schistosoma mansoni, Phil LoVerde/Joe Merrick
18158333386193AI068226EST209917Schistosoma mansoni, Phil LoVerde/Joe Merrick
18158893386249AI068282EST209973Schistosoma mansoni, Phil LoVerde/Joe Merrick
18159083386268AI068301EST209992Schistosoma mansoni, Phil LoVerde/Joe Merrick
18694063509807AI111119MF004A03.NK3S. mansoni, female enriched, subtractive, HHU(A)


Date: 13:9:6 on Sun 19 Nov 117.