CShisMan2_2807


Sequence

>CShisMan2_2807 (2 EST) Length=84 TGGATCGCATCGCACCCTTGATTTCTATTCGTTGATTGATAAGGACAGTGTCTCACCCGAGTCGTCGTTCGTCGGTATAG TCTC


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig,


Cluster Information for CShisMan2_2807: (2 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
7364541644590AA098620SMTBADAMS0595SKS. mansoni cDNA
16886363115406AA952310SMTBADA000595SKSchistosoma Lambda Zap II


Date: 6:43:27 on Sat 25 Nov 117.