CShisMan2_2816


Sequence

>CShisMan2_2816 (2 EST) Length=76 TCGGGTATAATAATCTAAACATTTCCTCATCTAGAATACTGAAAAGATCTACTAATAGACCATAAGGCCCTATAGC


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig,


Cluster Information for CShisMan2_2816: (2 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
344386972787L46919SCMRAP006G1/C2 Lung-stage schistosomula mini-library
344466972867L46999SCMRAP086G1/G2 adult worm mini-library


Date: 13:26:8 on Thu 23 Nov 117.