CShisMan2_2819


Sequence

>CShisMan2_2819 (2 EST) Length=74 TCTTATACTATAGAAGAAGACAAAGATGTAATCCATATGTGTTCTGCGCAGGAGGCAAACCTTGTATGTGGCGG


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig,


Cluster Information for CShisMan2_2819: (2 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
7364501644586AA098616SMTBADAMS0547SKS. mansoni cDNA
16715973096901AA938790SMTBADA000547SKSchistosoma Lambda Zap II


Date: 7:14:59 on Mon 20 Nov 117.