CShisMan2_282


Sequence

>CShisMan2_282 (4 EST) Length=503 AGGCAATTCAATTAAACAGACCGTTAAATTTAAATCGAAATAACCATATCAAATAGTACTCAGTAAAAAGAATAGAGTTG TACCTCAACCAACTTAAGAGCCTAATTTGCAACCTCTNATAAAGAAACTCACCNCTGTTCCANCTAANNGNCGCCAGCGT CATATGACGTNNNAATTTAGTTGGTGGAGCGATTTGTCTGGTTAATTCCGATAACGAACGAGACTTTAACCTGCTAAATA GTAGACTGGTCCTCTGTGCTCGTTTAGGGCGCGGCTTCTATTGCTTCTTTATGGAGTAGTGTGGTCGTGATCCGGCGGGT GCGGTGCCAGTTTTTACTTCTTAGAGGGCAAGCGGCACACTTAAGTCGCACGNAATTGAGCAATAACAGGTCTGTGATGC CCTTAGATGTCCGGGGCACACGTGCGCTACAATGACGGGTGCNGCGNGTCTGGAACCNGGCCGAAGGGTTGGAAACCTNT TAAACCGGNGGNCCTGGCCGGGC


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig, dbEST,


Cluster Information for CShisMan2_282: (4 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
4621771196844L76106SCMRAP0191C2/S1 day seven schistosomula mini-library
4621851196852L76114SCMRAP0199C2/S1 day seven schistosomula mini-library
4621891196856L76118SCMRAP0203C2/S1 day seven schistosomula mini-library
11826072160064L81201SCMRAP0207C2/S1 day seven schistosomula mini-library


Date: 23:29:24 on Sun 19 Nov 117.