CShisMan2_284


Sequence

>CShisMan2_284 (9 EST) Length=505 TAGTGTCACTGGTCCTTATCAGTGTTTCTATTTGATATACGCAGGATCCGGGTTAAAAACCTCGGTATTCGTGGCCGAAA CTTTGATGCAAAAGACCGGAGGATAGTTATAGGATACCAGAGGATCCAAACAATGACCATTAATATTCCTTTAGGATGCA GATTTGGTGCGATGAAGCAAACGAGTATTAAGAGATAAACCAGACACAAATCACTAGTATGTATTCCAACAAATCCAACT ATGCACAAAAGAGATGAACTAGTTAAGAAATGTAGAGTCGCGTTTCTATATCGAACTCTATGCACAAAAACAAGGAAGTT TATCAGTACATGACGCATGTGGACAAGACGTCTACAAAAATTCCAATAACACCAGTGATCTTCGTAACTTGGAGGCTTAT TGAACATTCTAGACAAAACTAAAGGTCCGAAGTAATCTATTGAGCTTAAAAGCAATCCTGAACAACCCATAACAAACAGG ATAGGTGGTTCGTATACGCTCGTGC


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig,


Cluster Information for CShisMan2_284: (9 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
18146713385031AI067064EST208734Schistosoma mansoni, Phil LoVerde/Joe Merrick
18147243385084AI067117EST208787Schistosoma mansoni, Phil LoVerde/Joe Merrick
18148753385235AI067268EST208943Schistosoma mansoni, Phil LoVerde/Joe Merrick
18150643385424AI067457EST209139Schistosoma mansoni, Phil LoVerde/Joe Merrick
18152143385574AI067607EST209289Schistosoma mansoni, Phil LoVerde/Joe Merrick
18153563385716AI067749EST209432Schistosoma mansoni, Phil LoVerde/Joe Merrick
18154743385834AI067867EST209551Schistosoma mansoni, Phil LoVerde/Joe Merrick
18156433386003AI068036EST209725Schistosoma mansoni, Phil LoVerde/Joe Merrick
18158623386222AI068255EST209946Schistosoma mansoni, Phil LoVerde/Joe Merrick


Date: 21:40:41 on Fri 17 Nov 117.