CShisMan2_287


Sequence

>CShisMan2_287 (2 EST) Length=754 CCACCACCAAAAACCTTTTTTGAAGATTAGGAAGTTGACTTCATATGAGCATTACTTCTTTATTGAATATTATCAATATC CAAGTAGATTCACATTTTACAAGCATCATCACATTCTTCTGATAAAACAGTAGCAATTCTGGTACATCTTTCGGATTATT TTTAAAACATCAATAATTGCTTATAATCAGGATGATTTACAACTTCTTTCTGTTCAAAATGATAAAGGACTTTACCACCT TTTTCGACTACAAGAAGTCCACCAGTTTGCCAACCATCTCCAGACATATTACCAGGTATATTAGCAGCCTTTGCCTTTGA ATTTAAAGAACGACCCAGCTTTCGTCAGTAAAGAACAGAAACCAGAACAGGCGGAGACTTTTTTGTATTCTAAACCTTTA TATGTCTTACGTTCACGATCTAAATAAAGATCTCCATCAAAATAATGTCCATCTAAAAATTCTTTTACACCACCTTCATC GAATGTAATTCCCATTAATTTGATATTGCGTGCATCCAAAACAGGTTTTAAGTAACTTAAATTTTAGCTTCCAGTCGGCA AAATTTACATCCCAAACGACGAAAGAATGTAATGATACATGTTTGATCTCGCCAAAATGAGTCCAAAGTACATGTTTGAG AGCCCAAAGCAGAATGTACAATGCAAGTACCAACCTTCGAGAGTAAAGGAGATGTCATTGCGGCTCAGCTAATAGTTTCT AGATTGCTACCAATCAATAACGCACATTGAAAAC


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig, gbnr, dbEST,


Cluster Information for CShisMan2_287: (2 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
4180021125891N20719SMNHADA007003SKSmAW
8733121858024AA233972SMIPADA000045M13RSchistosoma mansoni adult worm Lambda ZAP II library


Date: 14:9:25 on Mon 20 Nov 117.