CShisMan2_290


Sequence

>CShisMan2_290 (4 EST) Length=503 AAAAGAAATTCANTTTAAATTACAAAGNAAGAATAGACAAAGAGTACTGCAAACATTTTTTTTTCTCAATTATAAGCATA AAAATTAAATATGGCAACCGAGACGAAATTAAGTCAAATGGAAGAGTTTATTAGGGCATTTTTAGAAATAGATGCAGATA GTAATGAAATGATTGATAAACAAGAATTAATTAAATATCGTCAAAAATACCGTCTTGGGATATGAAATTGATCGATCCAT GGATAGCAAGGCTTGGATACGGATAAAGATAATACGGCACGAGATCAGTATAGAAGAGTTCTGTCGTGGATTTGGTTTAA AAGTATCAGAAATTCGACGTGAAAAAGATGAATTAAAAAAAGAAAGAGATGGCAAATTTCCTAAGCTTCCACCGAATATT GAAATTATTGCAGCAACCATGTCCAAAACAAAACAATATGAAATATGTTGTCAATTTAAGAGTNTGTTGATANATNCTAG NCGGACAGGGTCATGACATGAGA


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig, gbnr, dbEST,


Cluster Information for CShisMan2_290: (4 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
344937975993R95508SMNHADA018010SKSmAW
345049981316R95656SMNHADA020050SKSmAW
7364481644584AA098614SMTBADAMS0608SKS. mansoni cDNA
16886423115412AA952316SMTBADA000608SKSchistosoma Lambda Zap II


Date: 5:14:27 on Tue 21 Nov 117.