CShisMan2_292


Sequence

>CShisMan2_292 (2 EST) Length=554 TGAAGGGACGACCGAGAATGTATTCATAATCCGATCAGGATACTCCTCACGAATCTTTGAGATCAACAATGTCCCCATAC CTGAACCGGTACCACCACCGAGCGAATGAGTCAGTTGGAATCCTTGAAGGCAGTCACAAGATACCGCTTCTTTTCTGACC ACGTCTAAAACGGAATCCACAAGATCTGCTCCCTTCAGTGTAATGACCTTTAGCCCAATTATTTCCAGCGCCACTCTGTC CGAATACGAAATTATCAGGACGGAAAAGTTGACCGAAAGGTCCTGCACGAACACTATCCATTGTGCCTGGTTCTAAGTCC ACTAAGATAGCTCTTGGAACATATTTGCCACCGGATGCTTCATTGTAGTAAACATTGATTCGCTCAAGTTGTAAATCCGA GTCACCATGGTATGTTCCAGTTGGATCGATGCCATGTTCGTCAGAAATAACTTCCCAGAATTTGGCACCAATTTGGTTAC CGCATTGACCAGCTCGTACATGAACAATCTCACGCATGTTGAAACAAAGAAAACACGATACTAGTTCCTCGTGC


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig, gbnr, dbEST,


Cluster Information for CShisMan2_292: (2 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
11529272245762AA508322MAAD0417.M3RSchistosoma mansoni, adult worm (Rabelo, E. and Pena S.D.J.)
18153023385662AI067695EST209378Schistosoma mansoni, Phil LoVerde/Joe Merrick


Date: 9:39:47 on Fri 24 Nov 117.