CShisMan2_294


Sequence

>CShisMan2_294 (2 EST) Length=497 CATGGTGAAGTTAACGGTCCAAAAGTACCAACTGTTGTCGTATCATATAGTAGGCCATGAGGATATCTGTACATACACTT GTAAAAAAGTCGACTTCTGAAGATATTATTTCTCTTTTTGTCTGTCTCCATTTTCCTTCCAATTTTTAAAAATCTTATTT GAGGAATTCTCTTCAACTCCTTCCCTTGGTATTGTACAACTGTTTTGCGTTTTAAAATAAAATTCTACGTGTCTTTATGA ATTTAATGAAGTATAAAGCATAATGAGAGTGAATGAGTAGGACAGCAAGTCTGTGAAAGACTTTGTCTTCACCTGCCATT TATTGAATCTTTTATTCTTATAATCCTATTGACATATATATTTCATATGACTATATAGATTTTATCATAGAAATACAACA CTATTTTTCTCTCTTTTTCGTTTTTAAAAAGCCCCTTTATTTTTTGTATCATACAGATCAGAAAAAACAGTGTTTGCCTA TTTTCGATTTTTTTCCC


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig, dbEST,


Cluster Information for CShisMan2_294: (2 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
18694693509870AI110900MF003C11.NK3S. mansoni, female enriched, subtractive, HHU(A)
18695763509977AI111007MF002B08.NK3S. mansoni, female enriched, subtractive, HHU(A)


Date: 2:4:6 on Wed 22 Nov 117.