CShisMan2_298


Sequence

>CShisMan2_298 (6 EST) Length=495 GCACGAGAGAACAGAAAGAAACAGAGCAACATACAAAATGTTTATATTGATAATAATACTGACAATAACAGAGAATAGAA GAAAAGTGTATACACAAGTGTGTGTGTGTGTGAGAGAGAGAGATAGAAGTCTTGTGCACATACACATACACACACACACA CAAAATGGATCTATTTAAATATGTCAATTGGAATGATACTACCACAGAAATCAGTTTACATAAACATTCACCATAATGAA AGACTCACAATCTATTCACAAAATATAAAATATATTCATTTATAAATAATGAAAGACACAAGGTAAATAAATACTTCTAG CTAATATAGACAGGCAGGCGCGTATTTGTGGCTTATCTTTTCTTCCTTTATTATTAGACCATATCTTGCATGGGAATTTT TGAGAATGGATAATCAATATTATTTATGATGGCCAAATATCAGAACAATCATCAACGAATTTTTGAAGATGTGGTGTAAG TGTTTTAAAATGATC


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig, gbnr, dbEST,


Cluster Information for CShisMan2_298: (6 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
18146083384968AI067001EST208667Schistosoma mansoni, Phil LoVerde/Joe Merrick
18147753385135AI067168EST208839Schistosoma mansoni, Phil LoVerde/Joe Merrick
18148593385219AI067252EST208926Schistosoma mansoni, Phil LoVerde/Joe Merrick
18148613385221AI067254EST208928Schistosoma mansoni, Phil LoVerde/Joe Merrick
18149383385298AI067331EST209009Schistosoma mansoni, Phil LoVerde/Joe Merrick
18149403385300AI067333EST209011Schistosoma mansoni, Phil LoVerde/Joe Merrick


Date: 6:40:41 on Sat 25 Nov 117.