CShisMan2_299


Sequence

>CShisMan2_299 (4 EST) Length=502 AAACATTAAACAGTTTTGATGTACAGGTACAGAGATTTNTTTTGACCCACTTCATTAATCACGCAAATATGGTGCAGGTC ACGGAAATTATCATTATAGTCTAAAGCATAGCCAACGACAAATCGATTTGGAACTTCAAAACCAACAAAGTCTGGTCGGT AATCATTTCTGGGCGATGTTCGCTTGACGAGGAGGCTTGCGACTTTAACACTTTTCGTAGACAAACTATCCAAATGGCTT ATGAGTTTCGTTATTGTTTTTCCTGTGTCAATTATATCTTCGACCACAAGAACATTCTTATCTTTGTATTCCGAAGGATC TCCTAAACCAGTTAATATAGGTTCATGAATACTGACATCATTAACATAACTCTTGACACGAACAAACTCAACGGACATTG GTAGGACGATACCTCGAGCACGGACAGTGCGTTCAAGCCCATCAACAAGATCAGCAAGGAATTTAAATCCACCTTTGAGG ACACACATAAGTGTGCTCGTGC


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig, gbnr, dbEST,


Cluster Information for CShisMan2_299: (4 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
18145973384957AI066990EST208656Schistosoma mansoni, Phil LoVerde/Joe Merrick
18146513385011AI067044EST208713Schistosoma mansoni, Phil LoVerde/Joe Merrick
18147673385127AI067160EST208831Schistosoma mansoni, Phil LoVerde/Joe Merrick
18152443385604AI067637EST209320Schistosoma mansoni, Phil LoVerde/Joe Merrick


Date: 17:17:3 on Thu 23 Nov 117.