CShisMan2_300


Sequence

>CShisMan2_300 (3 EST) Length=496 GCGATTGGAACTTATCGTGGTCATGTTCAAATATGGGATGTGACTAAAAGTTCCTGCATACGCTCACTAAACGGACATAT CGCCCGTGTCGGTGCTTTGGCGTGGAATGCTGATCTTTTGGCATCTGGCAGCAAAAACCGTTATATTCTGTTACGTGATA CACGTGCTTCAGCCAATTCTGGTGGTGGACCCGCTGGTCATCTACCTATCACAAATCCCTCTAATACTTCTGTACTAACT GCTGAACTTGCTGATAGGGATGAAATTATGACTGATTTCAATTCCATTAGTTCACCGAGTCACATTGATCAAGTAGAAAG TGATTCAAACTATCCGCGGGCTTCAACACCTATGGTATCGATCAGTAGCGACCTTCCGGAAGTTGATCCTCCAAGTACAC CAGCTCAAATGGATATAGACATGCTTGGGTTTCGAGATGCGGATCACGGTTCGTCATGGTCTGCTGCAAGGACTTCAGCA AATTCACTGTCACCCA


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig, gbnr, dbEST,


Cluster Information for CShisMan2_300: (3 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
18694733509874AI110904MF003C06.NK3S. mansoni, female enriched, subtractive, HHU(A)
18694913509892AI110922MF003A11.NK3S. mansoni, female enriched, subtractive, HHU(A)
18696193510020AI111050MF001F04.NK3S. mansoni, female enriched, subtractive, HHU(A)


Date: 16:47:30 on Sat 18 Nov 117.