CShisMan2_302


Sequence

>CShisMan2_302 (2 EST) Length=615 CGCGAACACCCAAACTTTAATTTGTTTATCATAAGATGCAGAAGCTAAAAGACGTCCATCAGGTGAAACGGAANCTGAGC GTACCGGTGTGGNATGTCCAACCCAAAAACTTGAACACTCCCTGTTTCTAAATCCACAAATGCTGACAAGCCCATTGATT TGTTCCAGCAGCTAGCTTAAGATCCGTCAGAGATATAAGCAAGGCTGTACACGAATTTCCCCTCTAATTGAATAGAACCC TCTTTCTGAGCAGTTTGTACATTAATCATATTTACACAACCAGTATGACTTCCAGTTGCTAGGAAACGCGAATCAGGAGA AAAAGCAATAGTCCAGGTATCAGCTGGATCACCGTCATATGTTTTCGTTAATCTTCCTGTTTCCAGATCCCATAATAAAA TCTGGCTATCAAGACTGCTGGATGCTGCTAATGTACCGGTTGAATTTATGTCAACCGAAATCACACCCAACCTATGTCCT TCAAATTGATAAAGACATTTTAACTGACTATTAGTCCACTCCCAAGCAATGAGGCCATTATCCAAAGAACCTGTAATAAT GTACTGTTTATTTCTGTTCCGATTTTCACCCCATGTGCAGCACCATATTCNTTTC


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig, gbnr, dbEST,


Cluster Information for CShisMan2_302: (2 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
4190201126907N21737SMNHADA017012SKSmAW
18694763509877AI110907MF003C02.NK3S. mansoni, female enriched, subtractive, HHU(A)


Date: 12:50:29 on Sun 19 Nov 117.