CShisMan2_303


Sequence

>CShisMan2_303 (2 EST) Length=498 CGTGGTCAGTTGGATGAATCTGCATCTCGGAATGGATGTTCACTGTGGGACTGCAACCCAGTACCGTTCGCTTCAAACGC CATCACGTTATCCACTTACCTACTGAGTCCTCACAGTCACTTGCTTGTGCAATCGGTTCAAGTTGAAATTCACTTGACAT TGTTTACTTGAATAGTCCCATTGATGTTTAGCACTGCAATTGATCAGTGTGTTAGTGGCATATGTGCATACCGTGCGAGA TTGCCTCGATATTNGCCTCAATTGACAAGCATTGTAAGCNAAGATGTGTACTGGCTAGTAGTGGAATGCAGGACACTTGT TTCGACGTATTTGACACTGGTCAGTTGGATGAATCTGCATCTCGGAATGGATGTTCACTGTGGACTGCAACCAGTACCGT TCGCTTCAACGCATCACGTAATCACTACNTANTGGAGTCCTCACAGTCACTTGCTGGTGCCATCGGTTCAAGTTGAATTC ACTTGACATTGTTTACTG


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig,


Cluster Information for CShisMan2_303: (2 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
344839974642L47045SCMRAP1323303/TCZ2 adult worm mini-library
11826472160104L81241SCMRAP0360C2/S1 day seven schistosomula mini-library


Date: 16:13:48 on Tue 21 Nov 117.