CShisMan2_31


Sequence

>CShisMan2_31 (11 EST) Length=666 CAGCACGTGTAAAACGTGCATTACAACCAGGTTGATTACATAAATGTGGTTTAGCACCAGTATGTAAATGATAATGTTCA TTTAAATGAGAACGTTTATAATATGCTTGTGTACAATTAGGATATGTACATTTATAACGTTTTATACGTGGTGTAATTGA TGAATTTTCATTTATTTTCATTGAATTACAATGATCTATTTCTAAGTATTGATGAATTAATAATCTGGAATTAGATTCTA ATGTATTCTTAGGTGATTCAAAGAACATATCGTCATTCTGACTACTTGTATTATTATATGTAGCTGATGTTGATGAATAA TTGGAATGAAGAAATGAATTGAGATATAAAATTTGTTGATAATTATGTGTTGTTAAGAAATAGCGTAGAATACATTGGGT AGCTACTGCAAGGTACATTAATGTTGGATCCGAAGTATTATTACCGTTATTATTGATATGATCATTACCCACCAACCAGT CATTAGTACAATTTTGTATCTGATGATTTTGATGTTGTTGTTGCAATGAATTAAGATTTAAATCCATAGGAAATAAATAA GGGATCAATGTTGAGTAGAACTGATTATTATGTAATACAGTGTTATGACTTAATTGTGAATTGAAATTTAACAAAGAATC CATTATAAATGAGTTTGAGCTCGTGC


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig, gbnr, dbEST,


Cluster Information for CShisMan2_31: (11 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
18146413385001AI067034EST208703Schistosoma mansoni, Phil LoVerde/Joe Merrick
18146733385033AI067066EST208736Schistosoma mansoni, Phil LoVerde/Joe Merrick
18147253385085AI067118EST208788Schistosoma mansoni, Phil LoVerde/Joe Merrick
18147483385108AI067141EST208812Schistosoma mansoni, Phil LoVerde/Joe Merrick
18147823385142AI067175EST208847Schistosoma mansoni, Phil LoVerde/Joe Merrick
18148383385198AI067231EST208905Schistosoma mansoni, Phil LoVerde/Joe Merrick
18156593386019AI068052EST209741Schistosoma mansoni, Phil LoVerde/Joe Merrick
18158453386205AI068238EST209929Schistosoma mansoni, Phil LoVerde/Joe Merrick
18159103386270AI068303EST209994Schistosoma mansoni, Phil LoVerde/Joe Merrick
18159133386273AI068306EST209997Schistosoma mansoni, Phil LoVerde/Joe Merrick
18159683386328AI068361EST210053Schistosoma mansoni, Phil LoVerde/Joe Merrick


Date: 1:40:9 on Sat 18 Nov 117.