CShisMan2_311


Sequence

>CShisMan2_311 (21 EST) Length=616 GCACGAGCAATTATTGGCAGTGGTCTAAAAGAAAAAACACAATAAATTTCTTATTTTCCAATTACAATGATCATACCGAG TCGTTCCAAGTTCTACGAACAACGATAAAAAATGTTCCAAAGCTAAACTATAATAATGCAATTCTTTTTCTTATATAAAT ATGATAAATGAAACTGTAAAGCATGTAATAAGTATAGTAGTTTTGTGCTCTTTCTCTCTCTCTCTCTCCACTCTACATTG CGTAAATTTTTCTACCAATTTTCATACTTCATACTTTTATGTTTAAATAAAACTAACTCCTTTCAAAGCTCGTTATTCAT CCCATGAAGAATAAGATTTGTGCTGTCATGAATGTTTGTCGAGATACATTTTCTATTTGGTTTCCGTTTCAAAAGTCCAA GTTTAGTTGTTGGTGTAAGAGGAAGAAGAAAGTGAATTGCAAAACTGCTCATTCTTTTTTTAACTGATCAGTATTTGTCG TCATCATCTCTCTCCTTTTTTTCAGCTGTGTTTAGATTACTATTTATTGTAATAAAACTCTGATTTCTTTCTTTTTATAG CGCTAAACAAAAAACTTCCAAGTGTGTATTGGGACTTTGATTCCGTATATTCAAGC


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig, dbEST,


Cluster Information for CShisMan2_311: (21 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
4180151125904N20732SMNHADA007046SKSmAW
8247841769635AA185821MAAD0101.M2RSchistosoma mansoni, adult worm (Pena,H.B. and Pena,S.D.J.)
8247941769645AA185831MAAD0114.M2RSchistosoma mansoni, adult worm (Pena,H.B. and Pena,S.D.J.)
8247961769647AA185833MAAD0116.M2RSchistosoma mansoni, adult worm (Pena,H.B. and Pena,S.D.J.)
8247981769649AA185835MAAD0119.M2RSchistosoma mansoni, adult worm (Pena,H.B. and Pena,S.D.J.)
8248031769654AA185812MAAD0124.M2RSchistosoma mansoni, adult worm (Pena,H.B. and Pena,S.D.J.)
8248051769656AA185814MAAD0127.M2RSchistosoma mansoni, adult worm (Pena,H.B. and Pena,S.D.J.)
8248071769658AA185816MAAD0129.M2RSchistosoma mansoni, adult worm (Pena,H.B. and Pena,S.D.J.)
8248381769689AA185773MAAD0182.M2RSchistosoma mansoni, adult worm (Pena,H.B. and Pena,S.D.J.)
8248411769692AA185776MAAD0185.M2RSchistosoma mansoni, adult worm (Pena,H.B. and Pena,S.D.J.)
8248471769698AA185782MAAD0191.M2RSchistosoma mansoni, adult worm (Pena,H.B. and Pena,S.D.J.)
8248521769703AA185787MAAD0214.M2RSchistosoma mansoni, adult worm (Pena,H.B. and Pena,S.D.J.)
8248541769705AA185789MAAD0219.M2RSchistosoma mansoni, adult worm (Pena,H.B. and Pena,S.D.J.)
8248571769708AA185792MAAD0222.M2RSchistosoma mansoni, adult worm (Pena,H.B. and Pena,S.D.J.)
8248601769711AA185795MAAD0225.M2RSchistosoma mansoni, adult worm (Pena,H.B. and Pena,S.D.J.)
8248681769719AA185803MAAD0237.M2RSchistosoma mansoni, adult worm (Pena,H.B. and Pena,S.D.J.)
8248731769724AA185808MAAD0254.M2RSchistosoma mansoni, adult worm (Pena,H.B. and Pena,S.D.J.)
11529142245749AA508309MAAD0442.M3RSchistosoma mansoni, adult worm (Rabelo, E. and Pena S.D.J.)
11529492245784AA508344MAAD0358.M2RSchistosoma mansoni, adult worm (Rabelo, E. and Pena S.D.J.)
11529612245796AA508280MAAD0327.M2RSchistosoma mansoni, adult worm (Rabelo, E. and Pena S.D.J.)
11529632245798AA508282MAAD0321.M2RSchistosoma mansoni, adult worm (Rabelo, E. and Pena S.D.J.)


Date: 2:45:3 on Sat 25 Nov 117.