CShisMan2_316


Sequence

>CShisMan2_316 (6 EST) Length=692 GCTAGTTTTTGCAATGACTGTTTCTGGCGTTAGTGGTGGTTCATTAGCTGCTGCCCCTTCAACTGCTGGGGTAAGAAAAT CTGCAAAATCAAAAAAAGCCACCATCCATTCATCCTCCATATGGAGATATGATAAAAAAAGCCCTTAAAGAACTGAAAGA ACGCGGTGGGTCAAGTCGTCAAGCTATTGCTAAATATATCAAGACTAATTACAAAGTTGATGATNCGTGCAGAAAGTCAT CTACGTCGTGCTTTAGTTACTGGTGTCAAATCAGGCAAACTTGTCCACACTAAAGGAATTGGTGCATCTGGATCTTTCAA GCTTGCAGATAAATCTGTGACACCGAAAAAAGTTGCACGTCCTAAGACTTCAAAACCAAAAACTACTCCAAAGAAAAGTA TCTACGAAGAAGCCAAAAGTTGTCAAACCCAAATCAACCACCAATCCAACTAGTAAACCAGCCGCTTCAAAACCGAAAGC CACCAAACCCAAATCAACCGCTAAACCAAAGAAGGCCAAATCTCCACGTAAACCAAAAACTGTGAAGCCTAAGAAACCTG TGGCAAAGAAGACTCCGAAGAAAGTTGCAAAGAAATAGATGTGAATTATTTTATAGTTAATTCTTATTATTGTTACGTAT TAGCTTGTACATATGTTCCATACTTGTTTCATGTACATCCTGTATTCCTTAC


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig, gbnr, dbEST, Processing,


Cluster Information for CShisMan2_316: (6 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
5679251366673W59935EST000488S. mansoni cDNA
12100962330385AA559689MC031008.NA3TBRI-Saber-cercaria-A
12101882330477AA559781MC210250.NA3TBRI-Saber-cercaria-A
12165962338845AA566213MC3NE029.ACSS. mansoni cercarial Lambda Zap
16891843116553AA952847SMTBCEA000517SKSchistosoma Lambda Zap II cercariae
18151673385527AI067560EST209242Schistosoma mansoni, Phil LoVerde/Joe Merrick


Date: 18:26:39 on Sat 18 Nov 117.