CShisMan2_318


Sequence

>CShisMan2_318 (3 EST) Length=490 ACAATCACCATATCGTGAAAGTGTATGGCAAGATACTTTACGTTCAGACAATATAGAATCAGATTCACGTTTCTTATATG TAGCAAAGGATAATCTTACACAACAATTTGGATATACAAATGAAATACAACCTAATTCATTTTTATATAATCAATTATCT ATACCTGCTAGTAACACACCTAAGAATGAGTGTCAAACACTTGGTCGTCACTTAAAACGTCATACAACAGCATTTACGCA GCGAAATTATCAGGGTCAAGAATGTAGTATCAGAATAATTAGTAATCCAATGTCAAATAAGAAGCAACATTATCATATAC AACAAGAACTAACTCAACAATTCCTTAATCCACAACTTTTCCTATCAGATTATTCACCAGAAAATATGAAATATATCAAT CAACAAGCTAATAATAATCATAATCATAATACATTGACAAACTCTGGTATAGTTAGTGAATCCTGGTTAAACAACTCAAA TCCATTGATG


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig, dbEST,


Cluster Information for CShisMan2_318: (3 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
18146293384989AI067022EST208691Schistosoma mansoni, Phil LoVerde/Joe Merrick
18150103385370AI067403EST209084Schistosoma mansoni, Phil LoVerde/Joe Merrick
18152573385617AI067650EST209333Schistosoma mansoni, Phil LoVerde/Joe Merrick


Date: 14:38:8 on Sun 19 Nov 117.