CShisMan2_319


Sequence

>CShisMan2_319 (19 EST) Length=1303 ATATATCTACCAGATTAATTTATGTTTAATTCTTTGGATAAAAATTTAACAAACAATCTCAAGAAACGAAAATTAAGAAG CTTCATATCTAATACTTACTAATTGAAAAACAGAGAGAACATACATGAAAGGTCGAAAAGCTAGCTTTCTTTGGTACGTA AACATGCAGCAACCATGAGTCGTACGACTTTACCATTTGATCCCCGTTATAACCTCATTCAGAGTGGCAGCACTTTTTCT CAGTTTACACAATTCATCGTCACCAAGTTCAAGTGGGATCAAATGACTGATTCCAGATGAAGTAACGAGACATGGTAAAC TCAAATAAACATCTTCGTTGATTCCATGGATTCCTTTGACAGGAACAGAGAGTGGATAAACTGTATGAAGGTTATTTAAT AGTGCGTTACAAAGTGATCGACAGGTCAACCCGATTGCCCATGAGGTATAACCTTTCAAGCGAATAATGTCATAGGCACT CTGGACAACTTGTTTATGTATTTCTTCGAAGTTCTCAGGATCATCTTTGCATCCTATCTTCGGATTTAGAGAGGAAAGCC GAACTCCAGCAACATTCACATTACTCCAAACAGCAACACTCGAGTCACCATGCTCACCAATTACATATCCATGTACAGAG TTGGCAGACACTCCCAATTTCTCACCTAACAGAAAACGGAACCTCGCAGAGTCAAGCATTGTTCCGGTCCCAATTACTCT ATGGGCTTCAAATCCACTCAATTTTCGAGCAACATATGTCAAAATGTCCACAGGGTTCGACACGACAANTATGATGCATT TCGGNCTGTATTTGACAATATNTGGTAATATTTTCTTGAATATATCGACATTACGCTGAACAAGGTTCAGTNCGTGATTC TCCTTCGTTTNTGTCTGGCACCAGCAGTGATGACGACAATGTCTGAGTTTGCGGAGTATTTGTAGTCTGTTCCTCCATCA ATTTTACACCTGCCAAAAAACTGTTGACCATGTTGTAGGTCAAGAACTTCTCCTTTAACTTTATCTGCTACGACATCAAT GAGTGCAAGTTCTCCAGTTATTTGCATAGTCGAGAATGCTGCCGCCATTCCAACCATTCCAACACCTATAACAGTCACTT TACTACGAGAACGAGGCTCGACACTCGATGAAGCCACCGGTTTCATTAATAAGTTGCTAGATAACGGCATCCCAATAAAA AACAATTTAATCGGATAGACAATACGACCTTGTGTATGGTAAAGGCTGTTGTTGTTGATAAGTAGTTTGCAGACAGATGA AGCTAGTAGTCTTATGCTCGTGC


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig, gbnr, Processing,


Cluster Information for CShisMan2_319: (19 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
39126514520T14353SMEST0014Schistosoma mansoni, adult worm, Gloria Franco
39348514742T14575SMEST0236Schistosoma mansoni, adult worm, Gloria Franco
350221988852H49011EST000106S. mansoni cDNA
5137111444964W06744SMEST0380Schistosoma mansoni, adult worm, Gloria Franco
12099802330269AA559573MC070582.NA3TBRI-Saber-cercaria-A
12100572330346AA559650MC240711.NA3TBRI-Saber-cercaria-A
12101532330442AA559746MC140322.NA3TBRI-Saber-cercaria-A
15130222854302AA791347SMTBADA000836SKSchistosoma Lambda Zap II
16099842992133AA883022SMTBCEA000051SKSchistosoma Lambda Zap II cercariae
17372773190197AA999642MCCE3663.M1FSchistosoma mansoni, cercariae
17372783190198AA999643MCCE3664.M1FSchistosoma mansoni, cercariae
17581443233323AI018987SMEST0627Schistosoma mansoni, adult worm, Gloria Franco
17581723233351AI019015SMEST0655Schistosoma mansoni, adult worm, Gloria Franco
17609603237181AI021769ME0123.R1RSchistosoma mansoni, egg stage
18152293385589AI067622EST209305Schistosoma mansoni, Phil LoVerde/Joe Merrick
18153573385717AI067750EST209433Schistosoma mansoni, Phil LoVerde/Joe Merrick
18157503386110AI068143EST209833Schistosoma mansoni, Phil LoVerde/Joe Merrick
18695183509919AI110949MF002G07.NK3S. mansoni, female enriched, subtractive, HHU(A)
18696143510015AI111045MF001G01.NK3S. mansoni, female enriched, subtractive, HHU(A)


Date: 11:44:36 on Fri 24 Nov 117.