CShisMan2_32


Sequence

>CShisMan2_32 (4 EST) Length=662 GTTCTGTGTGCTGTCTAAGTACCAACGAAGTAATCTCTTCAGCTGCCTTCTGTTGTAAGCGTATATATTGTCGTAATTGT TCCATCTCGATATCTTGTAACTGTGTGAGGAGAAGACGCTTTGTCTTACGCGTTTCCAATGTGGACACATCATGCCGTCG CTTCCGAATAGCCTCTAACGGGTTGGAATGTCCACTGGAATCTGATTCATGCGAACTAAAAGAATCCAAATGGAGATTTT TTGGCCGACTTTAGTTCACTTTTCGTTTCAGTTTCAAGTTGACGTGCTAATTTCGATTCAACTGACATTGCTCTTTTGCG CTCTTTTTCTACTTCTGCGGCATGGATTTCTTCTAATCTCATGAATTCTTTTCTCATTGCTAACTTTGTTGCTTCATAGT CACGATTCAATCGTGATTTGAGTGATTCCTCCTCAACCTTATTTTTATCTTCAACTTGTTTTAGATGTTTATTGTGTTGA TTTCGAAGTCGTTTAAGTTCATTCATTTGATCACGCCAGTTAGCCATCCCTCTCCCATAACCCTGTTGCGTGAAGCCAAG AGCAACAGCAGCAGCTGAATTCGAAGCACCTGGTTCTAAAGACAGACCCCTCATCATCTGGGTAGTTTTTAGTGTTGCAA AATGACCAGCAGAAGATGAAAC


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig, gbnr, dbEST,


Cluster Information for CShisMan2_32: (4 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
18147123385072AI067105EST208775Schistosoma mansoni, Phil LoVerde/Joe Merrick
18148063385166AI067199EST208873Schistosoma mansoni, Phil LoVerde/Joe Merrick
18152763385636AI067669EST209352Schistosoma mansoni, Phil LoVerde/Joe Merrick
18153503385710AI067743EST209426Schistosoma mansoni, Phil LoVerde/Joe Merrick


Date: 18:44:8 on Sat 18 Nov 117.