CShisMan2_322


Sequence

>CShisMan2_322 (4 EST) Length=751 AACAAAAAGATAATATTCATTTAGGGGTACTCTTTCAGAATACTGTTCAGAATTTTTTTTAAAAAGGAAACCAGTAAAAA TGTACAATATGAATAATGTATGTATATTATTGTAGTGGGTTTGCAATACAAAAAGAAAATGCCAATACCAACAAAATAAA GGCAACTTTAAGATTAGAAGGTATAGTATAAAANATGAACAAAGCATATAATCAGAGCAAGTTTAATATATCCACAAATG GTACAAAATCACACATTACACAGGCTAACAGCACTTATTTGAAAAAGTAGATAGGGNCGTCACAAAATCCAGAGTCAGTA GTTATAGAAAAATGTAAGTCTGATTCTTTTGAACTTGAAGCTTATATAACAACTGAAAACGCTGCTGCAAGAAACTGTTC AAATGAAAACTGGNGCTTGACCAATCATTCTATAAGTCATATCGTCTGAATGCTCCCGTGAGAATTTGTAAACAGACACA TGCATAAATAAAATTCATCGAATGAAATAGATTCTCGACGATTACGACCAAAGCGACTAACCATAAAATTTATAAATTGT GGCGATAGGTTATAACCAAACCTCATCAACGCAGTACTGAGCTCTTGACGGTCAATTGAACCGGAGTTATCCCGATCAAA TTGTCGGAAACAATTTTGCCAATCATTTACATACTTGAAAAGTTTACCGAATTCATCAAAACTAATTGTTCCATTCATAT CAGAATCAAACATTGACATCATTAACTGTAC


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig, gbnr, dbEST, Processing,


Cluster Information for CShisMan2_322: (4 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
5679161366664W59926EST000444S. mansoni cDNA
7791021702761AA140601MEEG0138.M1FSchistosoma mansoni, egg stage
12098012330090AA559394MC100409.NA3TBRI-Saber-cercaria-A
16891713116540AA952834SMTBCEA000417SKSchistosoma Lambda Zap II cercariae


Date: 11:51:18 on Wed 22 Nov 117.