CShisMan2_323


Sequence

>CShisMan2_323 (2 EST) Length=490 AACTGTCAGTTATATATTTCTTGAGTATATTTCATGTATATATATATATTCCTGAATAACTCAAAACCACAATTAAGTCA ATCAGGAGAAAAAGGCAGAAGGGATCGAAAACGTAATATAACAAGAACAAACTCAAAGAAGAAGAAGAAGAACGAAACAA CTAGTTATTCTTTGCGTTGTCATAAATATAAAAAAATGTTGGCAAATGTAAATAAACATGTGAAATAAAAGATACACACA CAAGACATGGGATAAATACAAATGTTTCTTTCATTTTTTTGTATAGAATTCTATTAATAAGTAAGAACAAGGGATGACAA TGAAGTCAAACAAAAGGAGAAAAGGAGAGATAAGTACACACAAAACAAAGCCATGTATACATTTGACTACAAAAGTCAAT CGAAAAGAAAGGAAGAAAAACAAATCAAATAACATAAATAGTGAAATCGGGNTTAATCACAGACCTGCTATTACTGCACA TTTACTGGTG


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig, gbnr, dbEST,


Cluster Information for CShisMan2_323: (2 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
7641801685496AA125677MLLG0231.M1FSchistosoma mansoni, lung stage
7641811685497AA125678MLLG0232.M1FSchistosoma mansoni, lung stage


Date: 23:50:39 on Fri 17 Nov 117.