CShisMan2_327


Sequence

>CShisMan2_327 (2 EST) Length=498 TACATCACACGCTTGNGTTTTTCGAAGTTCTTCAGGAGCATTTTCGTTTTCTTGTGCATAGNAACTTCTTTAGCAGTTCA ACAGCTGCCTCCGCTTCAACTCCGGATATGCAGTTTAGTGGAGCGACTGCACTAGGAGNAATTGTGTACACTTAGGACTG ANCCACATCCACCGAACCGTTCATTACGAGCACCGTATGTGATACTTTTCAGATGAGCTGGAAGNACAAAACCGTATAGC AGCAGCACACATAATGCAGGGTTCTACTGTAACGAAAAGGTCACATTCGACCAAAATCTTGTCAAGTTCTTTTGGGTTAT TTCGACAACACTGTTCTAGTCGTCTTAATTGGCACCATCTCGGCATGTGGAGTAGCATCTCTAGTTGCATTTCACTTTCG GTGCGACCCAGATGCAATTACTTCTCCCATTGATAAACAAAAGCACACCCCTACTGGGACTTCATTACATCTCAGGGCTT CCACAAGCCCAATTTCGA


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig, gbnr, dbEST,


Cluster Information for CShisMan2_327: (2 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
4190171126904N21734SMNHADA017008SKSmAW
17372113190131AA999576MCCE3522.M1FSchistosoma mansoni, cercariae


Date: 8:17:33 on Thu 23 Nov 117.