CShisMan2_328


Sequence

>CShisMan2_328 (3 EST) Length=487 GGGAAACTGTTTGTCGGTGGTCTAAGCTGGGAAACAAATGAAAGTAAAGTATCGTGTTTGCTATTTACTATCTCCTCAGA TGATTTAAAGGAATATTTCTCTCGCTGGGGAAAAGTTACTCAGTGCATCATAAAACTGGATAGGTTTACAGGAAATTCAA GGGGATTTGGTTTTGTTACTTTGGAAAGTGAAGACTGTGTCTCGAAGGTTCTCAGTGTCCCTGAGCACTGGTTAAAGAAT AAGAAAATTGACCCTAAAAAAGCGAAACCTTCTCGAGAACCCTTGAAGAAGATTTTCGTTGGTGGTATTGATCCCGAAGT AACGGAAGACCAAATACGGGAATACTTTAGCAGTTTTGGAAAGGTTGAGTCCTTAGACTTGCCTTATGACACTCAAAAAG GGAAAAGAAAACATTACATATTCGTTAGTTTTTCTACCGAAGCGGCTGCTAAAAAAGCTATTTCAAAGGAGCGTCAAGAT ATTTTTG


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig, gbnr, dbEST,


Cluster Information for CShisMan2_328: (3 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
18150403385400AI067433EST209115Schistosoma mansoni, Phil LoVerde/Joe Merrick
18152853385645AI067678EST209361Schistosoma mansoni, Phil LoVerde/Joe Merrick
18154703385830AI067863EST209547Schistosoma mansoni, Phil LoVerde/Joe Merrick


Date: 16:12:13 on Fri 17 Nov 117.