CShisMan2_33


Sequence

>CShisMan2_33 (23 EST) Length=1169 TATNAAGTCNNGCTATCCTCACTANNTGGAACAAAAGCTGGAAGCTCCACCGCGCTGGCGGCCGCTCTAGAACTANTGGA TCCCCCGGNCTGCAGGAATTCGGCAGCACGAGGATCGATCAAAATCGTGATGGATTTATTGATATTGAAGATTTAAAAGA TATGTATGCATCATTGGGTCGGACACCAACTGATAAGGAATTAAAAGAAATGTTAGATGAATCACCTGGCCCATTGAATT TCACAATGTTTATCAACTTATTCGGTGAAAAACTAAATGGTACTGATCCTGAAGATGCACTACGTAATGCTTTTGCAATG TTTGATCCAGGAAACAAACGATATTTAGAAGAAGAATATATTAAAGATCTTTTACAAAATATGGGCGATAATTTTTCTGC TGAAGAGATAAGACAAACGTGGAAAGAAGCTCCAATCAAAGAAGGCAAATTGGATTACGATGGATTTGTAAATCTCATAA AGAGAGGCAATCAAGACATTTAGGACTAACATTTCCATAGAAAGGGTGAAAAAAAACTAAATTCATTCCCTTGCATATTC AGTCCCTTTTCCATTTATTATACCTTAATCAATAAATTTCCCCTATTTTCACGCCATACCAAATACATGCTTTCCCTCCT CTGTTTTGTTTTAGTTTCGAAAATATTGATGTATGTATTAGATTTCTTTTATCTTTAATAGTTCATACTCTTATTATTAT TCTGCATGATTAGTATATTATGTATGAGAGCTATTTGATTCGTTATTTTCTGATGGGAAGTCTTTTTAGTTTCATTTCCA TTGATTGAAACCTTTCCAGCTTTTGTCAACTATTCATTCCGTGCTGTGCTTTAGTTGTTGTGACCTTTACAATCTAACTT ATGAGATGAAGCGTATTAACGGATCCATTTATAGTTGGACAAGGACAGATAATAGTTATTTTCAGATCTGTTAACTTCTG GTGCTCGATTAATCAAAAAGCCTTATGTTTCATGATCAATCTGCTTACTTCGTCATTCAAAAACCGCCATTCTGCCATTG GTTATACTTATTTGAAAACGACCAGGTTCTTAATGGACCAGATCTCTATAGTCTTTGTGTATCTATTCTTCTGGTTTTTG AATATCTCTTCACTTTATGCTATTCTTAAAAAGTGTGCTTGAAAAAAGA


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig, gbnr, dbEST,


Cluster Information for CShisMan2_33: (23 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
39120514514T14347SMEST0008Schistosoma mansoni, adult worm, Gloria Franco
343545973949R95219SMNHADA002004SKSmAW
345055981322R95662SMNHADA020086SKSmAW
4291861145912N28056EST000004S. mansoni cDNA
8578101832570AA218477MAAD0141.M3RSchistosoma mansoni, adult worm (Rabelo, E. and Pena S.D.J.)
8578261832586AA218493MAAD0160.M3RSchistosoma mansoni, adult worm (Rabelo, E. and Pena S.D.J.)
8578311832591AA218498MAAD0165.M3RSchistosoma mansoni, adult worm (Rabelo, E. and Pena S.D.J.)
8578351832595AA218502MAAD0170.M3RSchistosoma mansoni, adult worm (Rabelo, E. and Pena S.D.J.)
11529232245758AA508318MAAD0425.M3RSchistosoma mansoni, adult worm (Rabelo, E. and Pena S.D.J.)
18148713385231AI067264EST208939Schistosoma mansoni, Phil LoVerde/Joe Merrick
18148963385256AI067289EST208966Schistosoma mansoni, Phil LoVerde/Joe Merrick
18149603385320AI067353EST209031Schistosoma mansoni, Phil LoVerde/Joe Merrick
18150503385410AI067443EST209125Schistosoma mansoni, Phil LoVerde/Joe Merrick
18150533385413AI067446EST209128Schistosoma mansoni, Phil LoVerde/Joe Merrick
18152913385651AI067684EST209367Schistosoma mansoni, Phil LoVerde/Joe Merrick
18153603385720AI067753EST209436Schistosoma mansoni, Phil LoVerde/Joe Merrick
18154483385808AI067841EST209525Schistosoma mansoni, Phil LoVerde/Joe Merrick
18155153385875AI067908EST209596Schistosoma mansoni, Phil LoVerde/Joe Merrick
18155553385915AI067948EST209636Schistosoma mansoni, Phil LoVerde/Joe Merrick
18156343385994AI068027EST209716Schistosoma mansoni, Phil LoVerde/Joe Merrick
18159253386285AI068318EST210009Schistosoma mansoni, Phil LoVerde/Joe Merrick
18159313386291AI068324EST210015Schistosoma mansoni, Phil LoVerde/Joe Merrick
18159573386317AI068350EST210041Schistosoma mansoni, Phil LoVerde/Joe Merrick


Date: 10:37:31 on Sat 18 Nov 117.