CShisMan2_333


Sequence

>CShisMan2_333 (10 EST) Length=628 ACTGTATTATTTATCAAAGAAGTGACAGTTTCAGAATTCAGTATGTTATTTTAGATAGTAATTTCAAGTAGAAATGTTAT TATTGATTCTATAGTTTCGAAACATTTGTGTTTATCAGCTGCATGATGTGTACATATATTCTTTATGATCGTCTCCTTAT ATTTTGGTGAGTTGGCTAAAGATAAGCCATAGTTTATATGATCATTAATACATGATGTAATTTCAGAATTTGATAGCATT GTGTGTTTATGGTGACAGAACCCTAGTTCAGAACATTCCAAAGTTACATTTATATGATCAGCGAATTCATGAATTTTCCT CGGTAAATAATGTGTAATATCTAGACACTCATTTCTCCAATGCCTTTCAGGAATTAATTTGCACATCTGATATAATACTC TTGAAGTTAATGGGATGAATGGTTCATCTTCAAGGAATATTTTTATCAGTCTTCCTATACGTCTACAAAGTCCGCATAAG AGATGACATTGTGGTCTTTCTAATTGTTCAGAGTATATATTCTCTTCATTTCCAAAAGTCACTTCACTTACACCCAATAT AACAATTAGAATGAAAAATTGTTTCAATATCATTTTTATTTTTCGTTTGTTCGTTTGTTTGTTTACAC


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig, dbEST,


Cluster Information for CShisMan2_333: (10 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
4179661125855N20683SMNHADA001008SKSmAW
4180461125935N20763SMNHADA008028SKSmAW
8577801832540AA218524MAAD0101.M3RSchistosoma mansoni, adult worm (Rabelo, E. and Pena S.D.J.)
8578051832565AA218472MAAD0134.M3RSchistosoma mansoni, adult worm (Rabelo, E. and Pena S.D.J.)
18694383509839AI111151MF003F06.NK3S. mansoni, female enriched, subtractive, HHU(A)
18694683509869AI110899MF003C12.NK3S. mansoni, female enriched, subtractive, HHU(A)
18694963509897AI110927MF003A06.NK3S. mansoni, female enriched, subtractive, HHU(A)
18696273510028AI111058MF001E06.NK3S. mansoni, female enriched, subtractive, HHU(A)
18696393510040AI111070MF001D05.NK3S. mansoni, female enriched, subtractive, HHU(A)
18696773510078AI111108MF001G06.NK3S. mansoni, female enriched, subtractive, HHU(A)


Date: 23:47:5 on Fri 17 Nov 117.