CShisMan2_334


Sequence

>CShisMan2_334 (17 EST) Length=491 TATAAGTGTAAGGATACTGCTTAGAAGAGTCATCAAATGATTCACGAGTGGCTCCATTACGGTATGATGGGAAGGAACTG GGTAATGTAGGAGCTGTTACATCTAGTGCATGCATAGTTTCAGTCTTTTGAGAGATAGGTTGAGATAAAACAGGATTTCC TCCGCTGGAAAATAAAGCTGAGGTTTTTGCAGATTCGATTATTGACTGCATTTCGGCTTTACTGCTCAGAAACAGGCGAA CAGATGCCCCATTGATCGTTTGTCGATCAAGCAGCATAGCTTTTCTTGCATCTTCGTCTGTAGCGAAAGCAATAAATGCG TCACCTTCCGTGCCCCCGACGATGTGCACACCCCCTTCAGGAATAGATAACCCGCTGAAAAAGCGTCGAATATTTGAGGC GTTTGCTGAAATTGGTAGGTTTTGTAGTCGAATGATGACAGACATCCTTTATTACGAAGCAATATGTATGTCCTGAGGTC TACCCTCGTGC


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig, gbnr,


Cluster Information for CShisMan2_334: (17 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
18146693385029AI067062EST208732Schistosoma mansoni, Phil LoVerde/Joe Merrick
18146903385050AI067083EST208753Schistosoma mansoni, Phil LoVerde/Joe Merrick
18147103385070AI067103EST208773Schistosoma mansoni, Phil LoVerde/Joe Merrick
18148393385199AI067232EST208906Schistosoma mansoni, Phil LoVerde/Joe Merrick
18150593385419AI067452EST209134Schistosoma mansoni, Phil LoVerde/Joe Merrick
18150813385441AI067474EST209156Schistosoma mansoni, Phil LoVerde/Joe Merrick
18152213385581AI067614EST209296Schistosoma mansoni, Phil LoVerde/Joe Merrick
18152403385600AI067633EST209316Schistosoma mansoni, Phil LoVerde/Joe Merrick
18152643385624AI067657EST209340Schistosoma mansoni, Phil LoVerde/Joe Merrick
18152723385632AI067665EST209348Schistosoma mansoni, Phil LoVerde/Joe Merrick
18152843385644AI067677EST209360Schistosoma mansoni, Phil LoVerde/Joe Merrick
18153143385674AI067707EST209390Schistosoma mansoni, Phil LoVerde/Joe Merrick
18153313385691AI067724EST209407Schistosoma mansoni, Phil LoVerde/Joe Merrick
18156483386008AI068041EST209730Schistosoma mansoni, Phil LoVerde/Joe Merrick
18157343386094AI068127EST209817Schistosoma mansoni, Phil LoVerde/Joe Merrick
18157743386134AI068167EST209858Schistosoma mansoni, Phil LoVerde/Joe Merrick
18159223386282AI068315EST210006Schistosoma mansoni, Phil LoVerde/Joe Merrick


Date: 21:21:15 on Fri 24 Nov 117.