CShisMan2_336


Sequence

>CShisMan2_336 (2 EST) Length=486 CTTCAACTCCATTAATCCCTCAATGATTTCTGATGGTCAACAATGTACATTTTATTTGATATACTTTNGTGATCTGAATT GTTCACCTTGAACCGCGAAAAATAAGCTGGACAAGTATCCTTATCAACATCATCATCTTCATCTAAGAAGCTATTCATTT TCTTCTTCAATTTCCTCATTGGAATGCATTCCAGTGAACACACTTACCTTCTTTGTTTTACATAACTCAAACATACATGC ACACTATTTCATTGTTCCTGTACTTCATAAACCTTAATGGTACTTCCTATTCCACAATCTCCTTTAATTAATTTCTTCAG ATTTTTTTGTACATTCGATTTCGTTTCTGTACTTACCTTTTTTCATCTTTATTCTATTGGTGTTTGGAATACTGTTTGAA ATCTTTCATTTTGCCTTCCGTTATCATCAACATGTTTGGTCTAATGCCTTTATTAGTTTATTTTTTTACAGAATTTTTAG TGTGTC


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig, gbnr, dbEST,


Cluster Information for CShisMan2_336: (2 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
18694553509856AI111168MF003E01.NK3S. mansoni, female enriched, subtractive, HHU(A)
18694753509876AI110906MF003C03.NK3S. mansoni, female enriched, subtractive, HHU(A)


Date: 15:12:10 on Fri 24 Nov 117.