CShisMan2_339


Sequence

>CShisMan2_339 (2 EST) Length=513 AAAGTTAAATTTGNTTGTTTAAANTGAATTAGTAGNCCATAAAGATCCTGCGGATTAAGATCAATTTAAAAACCCAATGA ACCCAAGTAAATACTTCATCGANANACATAACCTGCTTTTAGGTTTTCTGAGATTTCGACTTCCCACCCTATCACCATTT TGCAGCAATTTTTCTTTATTATATAGTAATTCTTCATGTGTTTCAGTAGAATATTCGAAGTTTGGTCCCTCTACGATGGC GTCTACTGGACACGCTTCCTGCCAAAACCCGCAATAAATGCACTTGGTCATATCAATATCATATCTAGTTGTCCTTCTAC TTCCATCAGCTCTTGGCTCAGCCTCAATAGTGATTGCTTGGGCTGGACATATAGCTTCGCAAAGTTTGCAAGCGATGCAC CGTTCCTCACCACTAGGGTACCTACGTAGAGCATGCTCACCACGAAATCTAGGACTGAGAGGACCCTTCTCGAAAGGGTA GTTTAAGGTTGCAGGCTCCTTGAAAATCATACC


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig, gbnr, dbEST,


Cluster Information for CShisMan2_339: (2 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
345040981307R95647SMNHADA020027SKSmAW
345052981319R95659SMNHADA020076SKSmAW


Date: 2:35:46 on Sat 25 Nov 117.