CShisMan2_342


Sequence

>CShisMan2_342 (15 EST) Length=615 GTTCACATTTCGGGAACGGATATGGTTCACAGCCTGTGTGATTTTCTTTCGAACTTCCAGTAACAAANACCNTCCTTCAC CCAAAAATCCCAAGCAGGACCAAGGATACCACCTTCACAACCAAGTCCACAACTTTCGCAACAGCTCAATAGATCAACAG CACTCAGTTCAACATTTTGTTTGCCACCTGACTGTATGCAGCTTCGATCACTCATTGCTTCGACCGCACCGAAAGCCCAA CATGATCCACATCGTGATTGATCACGAATGGTTGCGATACTTTTACAACCAGGCCATTTCTTCCTGGAATCGAAATTGGA TGGAATTTCCACATTCCATTCATTATGGTCAACTGTGGGACGTCTCTTCCTCCTCAAATCTGGTTCTTCTCTTCTTGCAC CCATCTGAATTCGTGCGTCATCCAGTGAGTGGAAACGGTTGCTTTTCTCAGCTCTCCATCCAGCATTCGGATGTTCATTG ATATACGAGATTATGTCATCTGACAATGGTTCAAACTTTTCGTTCTTAACTGAAATATGAGCTTCAAGAAAAGTTATTAG TGAAGCAATACACAAAATAGATGTGAGCATGTCCAAATAACTCTTCCCTCGTGCC


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig, gbnr, dbEST,


Cluster Information for CShisMan2_342: (15 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
39135514529T14362SMEST0023Schistosoma mansoni, adult worm, Gloria Franco
12097622330051AA559355MU001062.NH3York-Harrop-lung-A
12097972330086AA559390MC100403.NA3TBRI-Saber-cercaria-A
18146753385035AI067068EST208738Schistosoma mansoni, Phil LoVerde/Joe Merrick
18147023385062AI067095EST208765Schistosoma mansoni, Phil LoVerde/Joe Merrick
18147043385064AI067097EST208767Schistosoma mansoni, Phil LoVerde/Joe Merrick
18150853385445AI067478EST209160Schistosoma mansoni, Phil LoVerde/Joe Merrick
18151843385544AI067577EST209259Schistosoma mansoni, Phil LoVerde/Joe Merrick
18154263385786AI067819EST209503Schistosoma mansoni, Phil LoVerde/Joe Merrick
18155653385925AI067958EST209647Schistosoma mansoni, Phil LoVerde/Joe Merrick
18156163385976AI068009EST209698Schistosoma mansoni, Phil LoVerde/Joe Merrick
18159163386276AI068309EST210000Schistosoma mansoni, Phil LoVerde/Joe Merrick
18159523386312AI068345EST210036Schistosoma mansoni, Phil LoVerde/Joe Merrick
18694393509840AI111152MF003F05.NK3S. mansoni, female enriched, subtractive, HHU(A)
18694853509886AI110916MF003B05.NK3S. mansoni, female enriched, subtractive, HHU(A)


Date: 13:16:19 on Thu 23 Nov 117.