CShisMan2_343


Sequence

>CShisMan2_343 (4 EST) Length=421 ATTATTATTATTATCAATTACAAAATGAGTGAACGTAAAGCAGTTATTAAAAATGCTGATATGAGTGAAGAAAATGCAAG AGGATGCAATACATATAGCTGCTGGTGCTATAGATAAACATGATTTAGAAAAAGATATAGCTGCTAATATAAAAAAAGAT TTTGATCGAAAATATACTCCTAACTGGACTTGTATAGTGACGACATNNTGGAAGTTACGTAACACATGAAACCCANNATT TGATATNTTTCTATTTGGATGATCGAGCATTCCTTCTGTTTACNTCAGGATGAAAGGATGANTTTTTTTACAAAATGCAA ATCATGAAGACAATTATTATGTAACATNGGCAACCTTTGATGTATCTATTTAATGTATTTGGCTTGNCTTCATNTATGGT CTTCACTTACTGNATTACATG


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig, gbnr, dbEST, Processing,


Cluster Information for CShisMan2_343: (4 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
344936975992R95507SMNHADA018009SKSmAW
5679121366660W59922EST000439S. mansoni cDNA
7364771644613AA098643SMTBADAMS0709SKS. mansoni cDNA
16891113116480AA952774SMTBADA000709SKSchistosoma Lambda Zap II


Date: 9:19:32 on Sun 19 Nov 117.