CShisMan2_347


Sequence

>CShisMan2_347 (2 EST) Length=483 AAGATGCAACCAATTATTTAATTTTGTCACTTTGTACAAGATAATTTTGGAGTGCTCCGGATAACCATTTTTACATCTTC ATTTGAACATTATAAACAAAAGTCAAGAAAAGGAAATCAAATGAATAATCAACAAATAAATGCTGATTTTAATGGCGAAC TCATTGCAAAATAGAACTCTTTCTAATTAGATTATACATTCTTACAAAGGGTTTATTTCTTGATGTATTCAAAAAGGTTT CCTGATTATATCGTAAATCTTTTTTCCAAATGAAAAGAAATTCATTTCAGAAAATGGATTTAAAAGACGAATTTGATGAA TTAACTGAAAAAATAAACAGACGATAGACGATCAAACAACGTTAGTATCCCTGACCCAACGTTTTGCGTGATCGAAATAT ATTTTTCATAATAAGAATTGGTTTGTTATTTCTAACATAATAATATCCATTCTATATTGCACTTGAACCAAGTACTGGAG ATT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig, dbEST,


Cluster Information for CShisMan2_347: (2 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
17371483190068AA999513MCCE3422.M1FSchistosoma mansoni, cercariae
17371523190072AA999517MCCE3426.M1FSchistosoma mansoni, cercariae


Date: 1:13:26 on Mon 20 Nov 117.