CShisMan2_355


Sequence

>CShisMan2_355 (9 EST) Length=479 GGGGTACATCAATGCGTGCCAGTGTATTATTAAAGATACCCAAAACTTAGTTCTCAANCCGAAAAAGCTGGATGAAATTT GTGCAAAGTATATGCTTCAAGCTAGAGGTCTCTATGGTGAACATACAGAATCCCCTGATGGTACATATGATATTAGCAAT AAGCGCCGCCTTGGTTTAACTGAATTACAAGCAGCTCATGAAATGGCAGAAGGTGTTGCTAAAATGATTGAAATCGAGAA AGGACTGTAATATTACTTTAGACAATAATGTCCTTTTTTAGACAAATCAGTATAGACTACCAGTCCCTTGCTCTACTCAT TTTCCCTTCTTTCCTTTCACCTTTCATGTACCCTTTTATCGTCTAGATTTTTAATTAGTAGTTTTAAAATCAATGTATTT TAATCTAAAAAGTGTGATGCATTAGCTATACATTTTACTTTGGTTACTGTTCATAATACATAATTTGGTTAATATTATC


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig, gbnr, dbEST,


Cluster Information for CShisMan2_355: (9 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
12099642330253AA559557MC070561.NA3TBRI-Saber-cercaria-A
12099692330258AA559562MC070566.NA3TBRI-Saber-cercaria-A
12099992330288AA559592MC080520.NA3TBRI-Saber-cercaria-A
17368693189789AA999234MCCE3016.M1FSchistosoma mansoni, cercariae
17369243189844AA999289MCCE3098.M1FSchistosoma mansoni, cercariae
17370063189926AA999371MCCE3211.M1FSchistosoma mansoni, cercariae
17370073189927AA999372MCCE3213.M1FSchistosoma mansoni, cercariae
17371633190083AA999528MCCE3441.M1FSchistosoma mansoni, cercariae
17372123190132AA999577MCCE3524.M1FSchistosoma mansoni, cercariae


Date: 20:43:16 on Tue 21 Nov 117.